Gene drive and genetic sex conversion in the global agricultural pest *Ceratitis capitata*

Homing gene drives are designed to bias inheritance and can reduce populations of harmful insects by targeting genes essential for fitness via germline-expressed CRISPR endonucleases. Population size and impact are often driven by females; thus, strategies that impair female development or skew sex ratios towards males are attractive. While no gene drive has been field-tested yet, laboratory work in mosquitoes (e.g., Anopheles gambiae) has shown reliable elimination in cages, and frameworks for field testing are being developed. Tephritid fruit flies, including the Mediterranean fruit fly (medfly) Ceratitis capitata, are globally important agricultural pests, many of which are non-endemic in affected regions (e.g., medfly in the Americas). The current gold standard for suppression is the Sterile Insect Technique (SIT), which benefits from extensive operational expertise (mass rearing, release, monitoring). Recent advances have established CRISPR/Cas9 genome editing tools in several tephritids, including medfly, with endogenous regulatory elements for germline/somatic Cas9 and sgRNA expression and phenotypic markers. Sex determination in medfly is unusually malleable compared to mosquitoes or Drosophila. The Y-linked male-determining factor MoY overrides default female development, and perturbations can generate fertile XX males and XY females. This creates opportunities for true genetic sex conversion as a control strategy. Motivated by these factors, the study aimed to: (1) establish homing-capable gene drives at a phenotypic marker (white-eye) to evaluate germline homing performance with different promoters; (2) target the sex-determination pathway by disrupting transformer (tra) to explore sex-conversion gene drives; and (3) model integrated strategies that combine sex conversion with female sterility for robust population suppression.

The paper situates its work within two decades of gene drive research, noting successful laboratory suppression in malaria vectors and ongoing development across multiple insect species of medical, agricultural, and ecological relevance. It highlights SIT as the current standard for tephritid suppression and recent progress in CRISPR/Cas9 toolkit development for medfly, including promoter elements, markers, and mapped sex-determination components such as the Y-linked MoY factor. Prior studies have demonstrated the feasibility of sex ratio distortion and sex conversion in insects and identified transformer (tra) as a key regulator of female development in tephritids. These foundations motivate testing homing-based drives and sex-conversion approaches in medfly as an agricultural pest model.

- Species and rearing: Wild-type Benakeion and transgenic Ceratitis capitata strains maintained at 26 °C, 65% RH, 12:12 L:D. - Construct design: Homing constructs inserted into the white-eye gene (chromosome 5, GeneID_101458180) or into the transformer (Cctra) gene (chromosome 6, GeneID_101456163). Cas9 driven by endogenous germline promoters: nanos, vasa, or zpg, each with 5′ and 3′ regulatory regions; vasa promoter engineered to include multiple 5′UTR variants by removing an intronic segment while retaining promoter and UTR sequences. All constructs carried pUb-DsRed marker and a U6-driven gRNA; white-eye constructs targeted exon 3 of white-eye; tra drive targeted exon 1 of transformer. Homology arms (~1 kb) flanked the target cut sites for in-locus knock-in disrupting the target gene. - Plasmid assembly: Two-step Gibson assembly into pUK21 backbone. Specific restriction sites used for modular insertion of homology arms, Cas9 cassettes, and U6-gRNA cassettes. The additional gRNA_tra (sequence GTTGTTATTAAACGTAGATTTGG) was designed with CHOPCHOP v3. - Transgenesis: Embryo microinjections with donor plasmids (250 ng/µl) plus pre-assembled Cas9 RNP (200 ng/µl) and target gRNA (100 ng/µl). Founders were crossed to wild type; G1 screened for DsRed fluorescence; lines established from individual crosses. Correct insertion confirmed by PCR with primers binding to construct and flanking genomic regions, plus Sanger sequencing of target amplicons. - Crossing schemes and phenotyping: Hemizygous transgenic males or females were crossed to white-eye mutants or wild type to quantify inheritance bias (DsRed+ frequency) and to assess Cas9 cutting and parental deposition by scoring eye phenotypes (red/mosaic/white) among DsRed− and DsRed+ progeny. For the tra drive, only male transgenics were available; progeny were scored for fluorescence and sexual phenotype (male/female/intersex). For the white-eye+tra drive (vasa-driven Cas9 at white-eye with an additional gRNA targeting tra in trans), both male and female transgenics were crossed to wild type; progeny were scored for DsRed, sex, and eye color. - Genotyping and karyotyping: Multiplex PCR distinguished drive versus wild type alleles. Indels at both target sites were PCR-amplified and Sanger sequenced. Sex chromosome karyotyping (XX/XY) used published Y-specific primers. - Fecundity/fertility assays: Group crosses (10 transgenic males or intersexes with 20 wild-type virgin females; controls with wild-type) in triplicate; egg counts over 5 hours; hatch after 4 days; ANOVA (Dunnett’s) for comparisons. - Homing assays: Standard crosses (10 males x 20 females) for 10 generations for white-eye drives; white-eye+tra progeny scored for sex and eye phenotypes; tra drive progeny scored for 3–5 generations. - Gene drive modeling: SMS agent-based discrete-generation model with population size 1000; initial allele frequency 12.5% (500 WT females, 250 WT males, 250 hemizygous drive males). Explored parameter sweeps for Cas9 germline activity (with proportional maternal activity), R1 (functional) vs R2 (non-functional) resistance formation rates, and HDR vs NHEJ repair rates. Compared three designs: (i) canonical female fertility target; (ii) direct tra target; (iii) sterilising sex conversion (SSC): homing into a recessive female fertility gene while co-targeting tra in trans. Extinction likelihood/duration assessed over parameter grids and generations (e.g., HDR fixed at 0.95, 20 generations; R2/R1 at 0.99/0.01).

- Homing feasibility in medfly: - White-eye locus drives yielded super-Mendelian inheritance, especially from female germlines. Female transmission often >70%; nanos promoter highest mean at 85.6% in females. - Male germline drive was generally lower than female; vasa promoter achieved the best male transmission; nanos showed no observable male transmission bias. - zpg: cross to white-eye mutants showed significant super-Mendelian transmission (mean 57.5%, χ²=22.1, p<0.001), but not to wild type (mean 51.8%, χ²=0.71, p=0.3989). - vasa construct produced balanced drive: mean transmission 78.1% (to wild type males) and 70.7% (to wild type females). - Cas9 activity and parental deposition: - Among DsRed− progeny (non-homing chromosomes), estimated mutation rates for transgenic mothers: nanos 74.7%, vasa 35.4%, zpg 49.5%; for transgenic fathers: nanos 5.5%, vasa 36.2%, zpg 34.8%. - Crosses to wild type: white-eyed progeny frequencies from transgenic females indicated maternal deposition/somatic activity: nanos 42.2%, zpg 7.5%, vasa 87.1%; from transgenic males: 0% except vasa with rare white-eyed progeny (~0.049%), suggesting possible paternal carryover. - Overall, many unmodified chromosomes indicated Cas9 expression levels likely limit homing; somatic mosaics were absent in crosses to white-eye mutants but observed (some) in WT crosses. - tra drive (vasa-driven Cas9 inserted into tra): - Overall transmission 83.1% from transgenic males. - No transgenic females obtained; DsRed+ progeny comprised only intersexes (35.3%) and males (64.6%). - DsRed− progeny: males 44.7%, females 35.1%, intersexes 20.0%. Overall males 61.3% of total progeny. - Molecular analyses indicated somatic activity of Cas9 at tra causing mosaicism and sex conversion (XX intersex/XX males), explaining male bias among carriers. - Fertility: karyotyped XX transgenic males were fertile; XX non-transgenic males fertile (all-female progeny). XX intersexes were infertile. Despite gene drive transmission, XX transgenic males did not produce XX transgenic sons; intersexes predominated among their progeny. - White-eye + tra drive (vasa-driven Cas9 at white-eye; gRNA to tra in trans): - Transmission: females 72.4%, males 61.0%. - Male transgenics produced a weak male bias (52.8%; χ²=9.2, p=0.002) with sporadic intersexes; consistent with maternal WT tra provisioning. - Female transgenics produced a strong male bias: males 80.3%, intersexes 7.3%, indicating a strong maternal effect from targeting tra in ovaries. - Eye phenotypes: strong maternal effect from transgenic females led to almost exclusively white-eyed progeny; from male transgenics only 6.9% mosaic and 0.79% white-eyed, with 92% DsRed+. - Fecundity/fertility: no significant differences versus wild type for either sex. - Modeling sterilising sex conversion (SSC): - SSC (drive homing into a recessive female fertility gene while co-targeting tra) showed elevated tolerance to functional resistance (R1) compared to canonical designs, by converting genetic daughters of SSC females into fertile sons (due to disrupted maternal tra) and progressively sterilizing females via the female fertility target. - SSC minimizes immediate selection for resistant alleles at the fertility locus in embryos affected by maternal Cas9 deposition because progeny default to male development without maternal tra, delaying counterselection and enhancing robustness across cleavage/HDR parameter spaces.

The study demonstrates that medfly germlines support homing-based CRISPR-Cas9 gene drives with substantial inheritance bias, particularly using the vasa promoter, indicating that homing strategies are viable for tephritid agricultural pests. By placing the drive within white-eye, the authors quantified promoter-dependent differences in germline activity, parental deposition, and sex-specific performance, identifying Cas9 expression level/timing as a key limiter. Targeting transformer (tra) revealed the potential and challenges of sex conversion via gene drive. The tra drive, while showing strong homing, produced no transgenic females and a male-biased progeny among carriers due to somatic leakage of Cas9 and postzygotic cleavage, converting XX individuals to intersexes or males. This limited its utility as a population-wide drive in its current form but provided proof-of-concept that true genetic sex conversion (XX fertile males) can be achieved in medfly. Augmenting a white-eye drive with a tra-targeting gRNA in trans highlighted a strong maternal effect: female carriers produced predominantly male offspring and extensive white-eye phenotypes, consistent with disruption of maternal tra provisioning and germline targeting. These findings suggest that coupling inheritance bias with maternal disruption of tra can shift sex ratios towards males without reducing female fertility per se. Modeling supports that an SSC strategy—combining sex conversion (via tra) with homing into a recessive female fertility gene—can drive rapid suppression while being more tolerant to functional resistance alleles than canonical designs. SSC both shifts the sex ratio and reduces effective female fertility, while delaying selection for resistance at the fertility locus due to male development in embryos lacking maternal tra. Collectively, the work provides a roadmap for robust, species-specific genetic control of medfly and related tephritids.

This work establishes the feasibility of homing gene drives in Ceratitis capitata, identifies vasa-driven Cas9 as a promising regulatory configuration for both sexes, and provides experimental evidence that CRISPR-based drives can be coupled to sex conversion by targeting transformer. The white-eye+tra experiments reveal a strong maternal effect that can bias sex ratios towards males, and modeling indicates that a sterilising sex conversion (SSC) strategy—homing into a female fertility gene while co-targeting tra—could be highly effective and robust to resistant allele formation. Future directions include: optimizing regulatory elements to increase germline-restricted Cas9 activity (especially in males) and minimize somatic leak; re-targeting the white-eye+tra architecture to a validated recessive female fertility gene to implement SSC; comprehensive assessment of resistance allele formation and fitness effects; exploring confinement and reversibility designs; and translating these strategies to other tephritid pests, leveraging SIT operational infrastructures for potential field evaluation.

- Cas9 expression likely limiting in both sexes at tested loci; substantial fractions of uncut chromosomes indicate suboptimal expression levels/timing. - Somatic leakage of Cas9 with the tra drive caused postzygotic cleavage and sex conversion, generating many infertile intersexes and preventing recovery of transgenic females, limiting drive propagation. - Evidence for strong maternal deposition for some promoters (notably vasa) may increase embryo NHEJ at certain targets; paternal carryover appears minimal but not zero with vasa. - The tra drive’s male-biased progeny among carriers complicates straightforward interpretation and practical deployment; full dynamics of XX male fertility and inheritance require further investigation. - No field trials; modeling outcomes depend on parameter assumptions (cleavage, HDR, resistance formation) and discrete-generation agent-based structure; ecological and behavioral factors in wild populations remain untested.