A C-Terminally Truncated TDP-43 Splice Isoform Exhibits Neuronal Specific Cytoplasmic Aggregation and Contributes to TDP-43 Pathology in ALS

TDP-43 is a ubiquitously expressed RNA/DNA-binding protein that primarily resides in the nucleus and regulates multiple aspects of RNA metabolism, including transcription, alternative splicing, and mRNA stability/transport. In most ALS and FTLD cases, TDP-43 mislocalizes from the nucleus to the cytoplasm of affected neurons and forms ubiquitinated aggregates. Pathological tissue exhibits phosphorylated full-length TDP-43, a smear of ubiquitinated species, and lower molecular weight TDP-43 fragments. While some low molecular weight species arise from proteolytic cleavage (e.g., caspase-3, calpain, AEP), others result from alternative splicing of TARDBP. Several TARDBP transcript variants generated by alternative splicing in exon 6 produce C-terminally truncated proteins (sTDP-43) that retain the NLS but harbor a unique 18-amino-acid C-terminal sequence with a putative nuclear export sequence, and can form cytoplasmic aggregates in neurons. The research goal is to identify and characterize an additional C-terminally truncated TDP-43 splice isoform (TDP43C-spl), determine its expression, sequence features, and subcellular localization across cell types, and assess its contribution to ALS pathology using a novel antibody targeting the shared C-terminal unique sequence.

Prior studies identified lower molecular weight TDP-43 species in ALS/FTLD generated by proteases (caspase-3, calpain, AEP) and by alternative splicing of TARDBP. Multiple exon 6 splice variants (sTDP-43) lacking the glycine-rich C-terminal domain have been described in human and mouse, with three human transcripts sharing a unique 18 aa C-terminal motif containing a putative NES. sTDP-43 variants can mislocalize to the cytoplasm and aggregate in neurons despite retaining NLS, suggesting nuclear export contributes to pathology (Weskamp et al., 2020). TDP-43 autoregulates its expression through 3'UTR interactions affecting alternative polyadenylation and nuclear retention; loss of the glycine-rich domain impairs autoregulation. Disease contexts show widespread splicing alterations, including TARDBP itself, and cell-type differences in TDP-43 pathology have been observed (predominantly neuronal, also oligodendroglial). These works motivate investigation of additional splice variants, their conserved sequences, and cell-type-specific localization mechanisms.

• Cell culture: BV2 (mouse microglial), 1321N1 (human astrocytoma), SHSY5Y (human neuroblastoma), N2a (mouse neuroblastoma), HEK293T (human kidney). BV2, 1321N1, HEK293T in DMEM + 10% FBS; SHSY5Y in DMEM/F12 + 10% FBS; N2a in Opti-MEM + 10% FBS. Transfections with Lipofectamine 2000 (or LTX for depletion step) following manufacturer instructions.
• RNA sources: Human dorsal root ganglia (BD Biosciences), human lumbar spinal cord and motor cortex (Ambion), SHSY5Y total RNA (TRIzol) with DNase treatment. cDNA synthesis from 1 µg RNA using Oligo(dT)20 and SuperScript III.
• RT-PCR: Primers in exon 6 CDS (Forward: GAGAGGACTTGATCAT TAAAGGAATCAG) and 3'UTR (Reverse: TGAATGAGAAAGCATGTAGACAG). PCR with 2× Master Mix; initial 95°C 10 s; 35 cycles 95°C, 66°C 40 s; 72°C 7 min extension. Products cloned via TOPO TA and sequenced.
• Nested PCR and cloning: Adapter-primed cDNA [GGC CAC GCG TCG ACT AGT AC(T)17]. First PCR with TDP-43 5'-UTR forward and adapter reverse using PfuUltra polymerase (25 cycles, anneal 60°C, extend 4 min). Second PCR for TDP43-FL and TDP43C-spl using XhoI/BamHI-tagged primers (forward at ATG; reverse in 3'UTR for FL, alternative reverse for C-spl). Products gel-purified and subcloned into pEGFP-C2, pmRFP, or pcDNA3.1(-); sequence verified.
• Immunocytochemistry: Cells on coverslips fixed (4% PFA, 10 min, 4°C) or methanol (-20°C, 10 min for ubiquitin). Blocking in BSA/Triton. Primary antibodies: anti-ubiquitin mAb1510 (1:1000). Secondary Alexa 594 (1:350). Counterstain with DAPI. Imaging with Leica DM6000 and Volocity software. Paraspeckle co-localization assessed with SC-35 (Supplementary data).
• Protein extraction and western blotting: Fractionation into RIPA (1% SDS), low salt (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA), high salt (50 mM Tris pH 7.5, 750 mM NaCl, 5 mM EDTA, 1% Triton X-100), and urea buffer (7M urea, 2M thiourea, 4% CHAPS, 30 mM Tris-HCl pH 8.5). SDS-PAGE (10%), PVDF transfer, blocking in 5% milk. Primary antibodies: anti-TDP-43 (Proteintech; 1:1000), anti-ubiquitin (Chemicon; 1:1000). ECL detection.
• CTUS antibody generation: Rabbit polyclonal raised against peptide incorporating unique C-terminal sequence (VHLISNVYGRSTSLKVVL) appended to glycine-rich domain segment (ERSGRFGGNPVHLISNVYGRSTSLK). Affinity purification. Immunodepletion to remove cross-reactivity with TDP43-FL: HEK293T lysates expressing EGFP-TDP-43 captured with GFP-Trap beads; incubated with CTUS antibody to deplete cross-reactive species.
• Validation of CTUS specificity: Immunoblots of N2a lysates expressing EGFP-TDP43-FL, EGFP-TDP43-2, or untagged TDP43-2 probed with CTUS and anti-EGFP; assessed across salt/urea fractions.
• Human tissue immunostaining: ALS (n=4) and control (n=4) lumbar spinal cord paraffin sections. Deparaffinization, autofluorescence reduction (Maxblock), antigen retrieval (TE9, pressure cooker, 110°C, 15 min), blocking (donkey serum/BSA/Triton). Primary antibodies: CTUS (1:100), anti-TDP-43 (ab104223; 1:100), anti-neurofilament-H SMI-32 (1:500). Alexa Fluor secondaries (1:500). DAPI mounting. Peptide competition assays for specificity. Motor neuron identification by neurofilament labeling. Immunoblotting of tissue lysates probed with CTUS; GAPDH as loading control.
• Bioinformatics: UCSC Genome Browser GRCh38/hg38 transcript analysis; Translate tool for ORF; Compute pI/Mw for theoretical properties of TDP43C-spl.

• Identification of novel splice isoform: RT-PCR from human brain, spinal cord, DRG, and SHSY5Y detected major 1,150 bp product (TDP43-FL) and a ~134 bp band representing exon 6 splice variants. Sequencing confirmed a novel AU:AU splice event in exon 6 skipping 1,020 bp (region 769–1,788), termed TDP43C-spl.
• Protein features: TDP43C-spl encodes a 272 aa protein; first 256 aa identical to TDP43-FL; retains NLS, RRM1, and most of RRM2 (missing last 6 aa), lacks glycine-rich C-terminal domain. Theoretical pI/Mw 5.54 / ~30.53 kDa. C-terminus contains a unique 16 aa sequence (LISNVYGRSTSLKVVL) effectively matching the conserved 18 aa motif (VHLISNVYGRSTSLKVVL) found in three other human sTDP-43 transcripts.
• Cell-type-dependent localization: In non-neuronal lines (1321N1 astrocytoma, BV2 microglia), EGFP-TDP43-FL and EGFP-TDP43C-spl localized to the nucleus; TDP43C-spl formed nuclear speckles partially co-localizing with SC-35. In neuronal lines (SHSY5Y, N2a), EGFP-TDP43-FL remained nuclear, whereas EGFP-TDP43C-spl redistributed to cytoplasm and formed aggregates.
• Ubiquitination of aggregates: In N2a cells, cytoplasmic TDP43C-spl aggregates co-localized with ubiquitin immunoreactivity; regions of ubiquitin labeling without EGFP signal suggest additional proteins incorporated into aggregates.
• Biochemical solubility and aggregation: Sequential extraction showed TDP43C-spl partitions to urea-soluble fractions in both N2a and 1321N1 cells. In N2a cells expressing TDP43C-spl, RIPA fractions showed high molecular weight material trapped at gel interface and urea fractions displayed a high molecular weight smear that was ubiquitin-positive; these were absent in 1321N1 cells, consistent with neuronal cytoplasmic aggregation.
• No recruitment of full-length TDP-43: Co-transfection of N2a cells with EGFP-TDP43C-spl and RFP-TDP43-FL showed TDP43-FL confined to nucleus, with no detectable recruitment into cytoplasmic TDP43C-spl aggregates.
• Antibody validation and disease relevance: CTUS antibody specifically recognized the conserved C-terminal unique sequence in sTDP-43 isoforms (e.g., TDP43-2), without cross-reactivity to TDP43-FL. Immunoblots of lumbar spinal cord lysates showed increased ~30–34 kDa sTDP-43 species in ALS (n=4) compared to controls (n=4). Immunofluorescence of ALS motor neurons demonstrated CTUS co-labeling with TDP-43-positive skein-like and round cytoplasmic inclusions with partial overlap; control motor neurons lacked CTUS staining. Peptide competition confirmed specificity.

The study addresses how C-terminally truncated TDP-43 splice variants contribute to ALS/FTLD pathology and why neurons exhibit selective vulnerability. Identification of TDP43C-spl, which shares the conserved C-terminal unique sequence (harboring a putative NES), supports a mechanism whereby alternative splicing generates TDP-43 isoforms predisposed to cytoplasmic export and aggregation. The observed cell-type dependency—nuclear retention in glial lines versus cytoplasmic aggregation and ubiquitination in neuronal lines—suggests differences in nuclear export/import machinery or interacting factors across cell types may drive neuronal specificity of TDP-43 pathology. Biochemical data align with imaging, showing urea-soluble, ubiquitinated high molecular weight species in neuronal cells expressing TDP43C-spl, consistent with aggregated forms. The CTUS antibody establishes disease relevance: elevated sTDP-43 isoforms in ALS spinal cord and incorporation into pathological TDP-43 inclusions. Together, these findings support a significant contribution of C-terminal splice variants to TDP-43 mislocalization and aggregation, offering a tractable model to dissect the molecular basis of neuronal vulnerability and the role of the conserved C-terminal sequence/NES in pathology.

This work identifies and characterizes a novel TDP-43 C-terminal splice isoform, TDP43C-spl, that retains N-terminal domains but lacks the glycine-rich C-terminus, and shares a conserved unique C-terminal sequence with other sTDP-43 variants. TDP43C-spl exhibits cell-type-specific subcellular localization, forming ubiquitinated cytoplasmic aggregates in neuronal cells but remaining nuclear in glial lines. A newly developed CTUS antibody demonstrates increased sTDP-43 isoforms in ALS spinal cord and their incorporation into TDP-43-positive motor neuron inclusions, implicating C-terminal splice variants in disease pathology. Future research should elucidate mechanisms governing cell-type-specific nuclear export/import, define how the conserved C-terminal sequence mediates mislocalization, clarify interactions within aggregates, and assess physiological roles of sTDP-43 isoforms in vivo, potentially informing therapeutic strategies targeting aberrant splicing or nuclear export.

• The mechanistic basis for cell-type-specific localization (e.g., activity of the putative NES within the conserved C-terminal sequence) remains unresolved.
• Use of overexpression in cell lines may not fully recapitulate endogenous regulation and interactions; EGFP tagging at the N-terminus may sterically hinder oligomerization and affect recruitment of TDP43-FL.
• Human tissue analyses were limited to lumbar spinal cord samples (n=4 ALS, n=4 controls) without quantitative densitometry provided; specific sTDP-43 isoforms contributing to CTUS signal were not individually resolved.
• The study does not directly assess functional consequences (e.g., RNA binding, splicing activity) of TDP43C-spl beyond localization and aggregation propensity.